Review



5x primescript buffer takara clontech  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    TaKaRa 5x primescript buffer takara clontech
    5x Primescript Buffer Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 10921 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5x+primescript+buffer+takara+clontech/PrimeScript+RT-PCR+Kit/pm34469751-374-133-136
    Average 98 stars, based on 10921 article reviews
    5x primescript buffer takara clontech - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Magnetic Beads:

    Article Title: Diversity of developing peripheral glia revealed by single-cell RNA sequencing.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti mouse Mbp Abcam Cat # ab40390; RRID: AB_1141521 Rabbit monoclonal to Ki67 Vector Laboratories Cat # VP-RM04; RRID: AB_2336545 Rabbit polyclonal to GFP Abcam Cat # ab6556; RRID: AB_305564 Chicken polyclonal to GFP Aves Cat# GFP-1010; RRID: AB_2307313 Goat polyclonal to Sox10 Santa Cruz Biotechnology Cat# sc-17342-discontinued; RRID: AB_2195374 Mouse monoclonal anti rat Tuj1 Biolegend Cat # 801202; RRID: AB_10063408 Rat monoclonal anti Mbp Abcam Cat# ab7349; RRID: AB_305869 chicken anti-Neurofilament Millipore Sigma Cat# AB5539; RRID: AB_11212161 Donkey anti-rabbit, Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 Donkey anti-goat, Alexa Fluor 647 Invitrogen Cat# A-21447; RRID: AB_2535864 Donkey anti-rabbit, Alexa Fluor 647 Life Technologies Cat# A31573; RRID: AB_2536183 Donkey anti-rabbit, Alexa Fluor 568 Life Technologies Cat# A10042; RRID: AB_2534017 Donkey anti-mouse, Alexa Fluor 647 Life Technologies Cat# A31571; RRID: AB_162542 Donkey anti-rat DyLight 488 Novus Biologicals Cat# NBP1-75383; RRID: AB_11028555 Donkey anti-chicken, Alexa Fluor 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Chemicals, peptides, and recombinant proteins Collagenase IV Worthington Cat# LS004186 Papain Dissociation System (Papain, EBSS, ovomucoid inhibitor, DNAse I) Worthington Cat# LKLK003150 Trypsin Worthington Cat# LS004452 Polystyrene Round-Bottom tube with cellstrainer cap Falcon Cat# 352235 Proteinase K Sigma-Aldrich Cat# P6556 PFA Thermo Fisher Scientific Cat# 50980492 DEPC Sigma-Aldrich Cat# D5758 PBS (10X), RNase-free Life Technologies Cat# AM9624 Triton X-100 Millipore Cat# 648462 ImmEDGE Hydrophobic Barrier Pen Vector Laboratories Cat # NC9545623 SSC (20X) ThermoFisher Cat # 15557-044 Tween-20 Sigma-Aldrich Cat# P2287-500ML Prolong Gold antifade reagent Cell Signaling Technology Cat # 9071S Donkey serum Sigma-Aldrich Cat# D9663 BSA, IgG and protease-free Jackson ImmunoResearch Cat# 001-000-162 DAPI Life Technologies Cat # D1306 Fluoromount-G Southern Biotech Cat# 0100-01 OptiPrep Density Gradient Medium Sigma-Aldrich Cat# D1556-250ML HBSS (10X), calcium, magnesium, no phenol red Life Technologies Cat# 14065056 HBSS (10X), no calcium, no magnesium, no phenol red Life Technologies Cat# 14175103 FBS Sigma-Aldrich Cat# F2442 HEPES (1M) Gibco Cat# 15630-080 5X First Strand Buffer Thermo Fisher Scientific Cat# 18080-044 Igepal CA-630 Sigma-Aldrich Cat# 56741 (Continued on next page) e1 Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER HFE-7500 oil Novec Cat# Novec 7500 MgCl2(1M) (nuclease-free) Thermo Fisher Scientific Cat# AM9530G DTT Invitrogen Cat# 00147 RNaseOUT (40 U/ml) Thermo Fisher Scientific Cat# 10777-019 SuperScript III (200 U/ml) Thermo Fisher Scientific Cat# 18080-044 Carrier oil RAN Biotechnologies Cat# 08-FluoroSurfactant-2wtH-50G Nuclease-free water Life Technologies Cat# 10977015 FastDigest Buffer (10X) Thermo Fisher Scientific Cat# B64 ExoI (20 U/ml) Life Technologies Cat# EN0581 ExoI reaction buffer (10X) NEB Cat# B0293S FastDigest HinfI Thermo Fisher Scientific Cat# FD0804 Agencourt AMPure XP magnetic beads Beckman Coulter Cat# A63881 NEBNext mRNA Second Strand Synthesis Module NEB Cat# E6111S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S RNA Fragmentation Reagents Ambion/Life Technologies Cat# AM8740 dNTP (10 mM each) NEB Cat# N0447L PrimeScript RT-PCR Kit (including PrimeScript Reverse Transcriptase (200 U/ ml) and 5x PrimeScript Buffer) Takara Clontech Cat# RR014A Kapa 2X HiFi HotStart PCR mix Kapa Biosystems Cat# KK2601 EvaGreen Dye (20X) Biotium Cat# 31000-T NextSeq 500 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 BioAnalyzer RNA pico chip and reagents Agilent Cat# 5067-1513 Bioanalyzer HS DNA chip and reagents Agilent Cat# 50674626 Qubit dsDNA HS Assay Kit Life Technologies Cat# Q32851 KAPA Library Quantification Kit Roche Cat# 07960140001 EDTA (0.5M) Thermo Fisher Scientific Cat# 15575020 Tris-HCl, pH 8.0 (1M) Thermo Fisher Scientific Cat# 15568025 Tris-HCl, pH 7.0 (1M) Thermo Fisher Scientific Cat# AM9851 Mineral oil Sigma-Aldrich Cat# M5310-1L NEG-50 frozen section medium Richard-Allan Scientific Cat# 6502 1H,1H,2H,2H-Perfluorooctanol Alfa Aesar Cat# B20156 Ethanol, 200 proof (100%) Decon Labs Cat# 22-032-601 Aquapel Aquapel Cat# 47100 TSA Plus Cyanine 5 PerkinElmer Cat# NEL745E001KT TSA Plus Cyanine 3 PerkinElmer Cat# NEL744E001KT Quadrol (N,N,N’,N’-Tetrakis(2hydroxypropyl)ethylenediamine Tokyo Chemical Industry Cat# T0781 Urea Nacalai Tesque Cat# 35904-45 Sucrose Nacalai Tesque Cat# 30403-55 Triethanolamine (2,2’,2’’-Nitrilotriethanol) Wako Cat# 145-05605 Tri-sodium citrate (dihydrate) Sigma-Aldrich Cat# S1804 Oligonucleotides R1-N6 primer (100 mM) (v3): 5’TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG(N1:25252525) (N1)(N1) (N1)(N1)(N1)3’ This study Integrated DNA Technologies (Continued on next page) Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ai14 The Jackson Laboratory; (Madisen et al., 2010) Rosa26-tdTomato Stock #: 007914 Mouse: NpyCre Qiufu Ma (Dana-Farber Cancer Institute/ Harvard Medical School): (Bourane et al., 2015) Tg(Npy-cre)RH26Gsat/Mmucd MMRRC:034810-UCD Mouse: NPY-GFP The Jackson Laboratory; (van den Pol et al., 2009) B6.FVB-Tg(Npy-hrGFP)1Lowl/J Stock #: 006417 Software and algorithms Conos https://github.com/kharchenkolab/conos N/A Pagoda2 https://github.com/kharchenkolab/ pagoda2 N/A Pagoda2 webpage of single-cell RNA-seq dataset http://pklab.med.harvard.edu/peterk/p2/ smallMem2/index.html?fileURL=http:// pklab.med.harvard.edu/peterk/rosalind/ conE_feb6.bin N/A Indrops pipeline https://github.com/indrops/indrops N/A Processing code of Conos, trajectory and cell composition analyses https://github.com/kharchenkolab/ mouseCochlea N/A Deposited data Single-cell RNA-seq data This study [Database]: Accession # GSE172110

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Diversity of developing peripheral glia revealed by single-cell RNA sequencing.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti mouse Mbp Abcam Cat # ab40390; RRID: AB_1141521 Rabbit monoclonal to Ki67 Vector Laboratories Cat # VP-RM04; RRID: AB_2336545 Rabbit polyclonal to GFP Abcam Cat # ab6556; RRID: AB_305564 Chicken polyclonal to GFP Aves Cat# GFP-1010; RRID: AB_2307313 Goat polyclonal to Sox10 Santa Cruz Biotechnology Cat# sc-17342-discontinued; RRID: AB_2195374 Mouse monoclonal anti rat Tuj1 Biolegend Cat # 801202; RRID: AB_10063408 Rat monoclonal anti Mbp Abcam Cat# ab7349; RRID: AB_305869 chicken anti-Neurofilament Millipore Sigma Cat# AB5539; RRID: AB_11212161 Donkey anti-rabbit, Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 Donkey anti-goat, Alexa Fluor 647 Invitrogen Cat# A-21447; RRID: AB_2535864 Donkey anti-rabbit, Alexa Fluor 647 Life Technologies Cat# A31573; RRID: AB_2536183 Donkey anti-rabbit, Alexa Fluor 568 Life Technologies Cat# A10042; RRID: AB_2534017 Donkey anti-mouse, Alexa Fluor 647 Life Technologies Cat# A31571; RRID: AB_162542 Donkey anti-rat DyLight 488 Novus Biologicals Cat# NBP1-75383; RRID: AB_11028555 Donkey anti-chicken, Alexa Fluor 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Chemicals, peptides, and recombinant proteins Collagenase IV Worthington Cat# LS004186 Papain Dissociation System (Papain, EBSS, ovomucoid inhibitor, DNAse I) Worthington Cat# LKLK003150 Trypsin Worthington Cat# LS004452 Polystyrene Round-Bottom tube with cellstrainer cap Falcon Cat# 352235 Proteinase K Sigma-Aldrich Cat# P6556 PFA Thermo Fisher Scientific Cat# 50980492 DEPC Sigma-Aldrich Cat# D5758 PBS (10X), RNase-free Life Technologies Cat# AM9624 Triton X-100 Millipore Cat# 648462 ImmEDGE Hydrophobic Barrier Pen Vector Laboratories Cat # NC9545623 SSC (20X) ThermoFisher Cat # 15557-044 Tween-20 Sigma-Aldrich Cat# P2287-500ML Prolong Gold antifade reagent Cell Signaling Technology Cat # 9071S Donkey serum Sigma-Aldrich Cat# D9663 BSA, IgG and protease-free Jackson ImmunoResearch Cat# 001-000-162 DAPI Life Technologies Cat # D1306 Fluoromount-G Southern Biotech Cat# 0100-01 OptiPrep Density Gradient Medium Sigma-Aldrich Cat# D1556-250ML HBSS (10X), calcium, magnesium, no phenol red Life Technologies Cat# 14065056 HBSS (10X), no calcium, no magnesium, no phenol red Life Technologies Cat# 14175103 FBS Sigma-Aldrich Cat# F2442 HEPES (1M) Gibco Cat# 15630-080 5X First Strand Buffer Thermo Fisher Scientific Cat# 18080-044 Igepal CA-630 Sigma-Aldrich Cat# 56741 (Continued on next page) e1 Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER HFE-7500 oil Novec Cat# Novec 7500 MgCl2(1M) (nuclease-free) Thermo Fisher Scientific Cat# AM9530G DTT Invitrogen Cat# 00147 RNaseOUT (40 U/ml) Thermo Fisher Scientific Cat# 10777-019 SuperScript III (200 U/ml) Thermo Fisher Scientific Cat# 18080-044 Carrier oil RAN Biotechnologies Cat# 08-FluoroSurfactant-2wtH-50G Nuclease-free water Life Technologies Cat# 10977015 FastDigest Buffer (10X) Thermo Fisher Scientific Cat# B64 ExoI (20 U/ml) Life Technologies Cat# EN0581 ExoI reaction buffer (10X) NEB Cat# B0293S FastDigest HinfI Thermo Fisher Scientific Cat# FD0804 Agencourt AMPure XP magnetic beads Beckman Coulter Cat# A63881 NEBNext mRNA Second Strand Synthesis Module NEB Cat# E6111S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S RNA Fragmentation Reagents Ambion/Life Technologies Cat# AM8740 dNTP (10 mM each) NEB Cat# N0447L PrimeScript RT-PCR Kit (including PrimeScript Reverse Transcriptase (200 U/ ml) and 5x PrimeScript Buffer) Takara Clontech Cat# RR014A Kapa 2X HiFi HotStart PCR mix Kapa Biosystems Cat# KK2601 EvaGreen Dye (20X) Biotium Cat# 31000-T NextSeq 500 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 BioAnalyzer RNA pico chip and reagents Agilent Cat# 5067-1513 Bioanalyzer HS DNA chip and reagents Agilent Cat# 50674626 Qubit dsDNA HS Assay Kit Life Technologies Cat# Q32851 KAPA Library Quantification Kit Roche Cat# 07960140001 EDTA (0.5M) Thermo Fisher Scientific Cat# 15575020 Tris-HCl, pH 8.0 (1M) Thermo Fisher Scientific Cat# 15568025 Tris-HCl, pH 7.0 (1M) Thermo Fisher Scientific Cat# AM9851 Mineral oil Sigma-Aldrich Cat# M5310-1L NEG-50 frozen section medium Richard-Allan Scientific Cat# 6502 1H,1H,2H,2H-Perfluorooctanol Alfa Aesar Cat# B20156 Ethanol, 200 proof (100%) Decon Labs Cat# 22-032-601 Aquapel Aquapel Cat# 47100 TSA Plus Cyanine 5 PerkinElmer Cat# NEL745E001KT TSA Plus Cyanine 3 PerkinElmer Cat# NEL744E001KT Quadrol (N,N,N’,N’-Tetrakis(2hydroxypropyl)ethylenediamine Tokyo Chemical Industry Cat# T0781 Urea Nacalai Tesque Cat# 35904-45 Sucrose Nacalai Tesque Cat# 30403-55 Triethanolamine (2,2’,2’’-Nitrilotriethanol) Wako Cat# 145-05605 Tri-sodium citrate (dihydrate) Sigma-Aldrich Cat# S1804 Oligonucleotides R1-N6 primer (100 mM) (v3): 5’TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG(N1:25252525) (N1)(N1) (N1)(N1)(N1)3’ This study Integrated DNA Technologies (Continued on next page) Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ai14 The Jackson Laboratory; (Madisen et al., 2010) Rosa26-tdTomato Stock #: 007914 Mouse: NpyCre Qiufu Ma (Dana-Farber Cancer Institute/ Harvard Medical School): (Bourane et al., 2015) Tg(Npy-cre)RH26Gsat/Mmucd MMRRC:034810-UCD Mouse: NPY-GFP The Jackson Laboratory; (van den Pol et al., 2009) B6.FVB-Tg(Npy-hrGFP)1Lowl/J Stock #: 006417 Software and algorithms Conos https://github.com/kharchenkolab/conos N/A Pagoda2 https://github.com/kharchenkolab/ pagoda2 N/A Pagoda2 webpage of single-cell RNA-seq dataset http://pklab.med.harvard.edu/peterk/p2/ smallMem2/index.html?fileURL=http:// pklab.med.harvard.edu/peterk/rosalind/ conE_feb6.bin N/A Indrops pipeline https://github.com/indrops/indrops N/A Processing code of Conos, trajectory and cell composition analyses https://github.com/kharchenkolab/ mouseCochlea N/A Deposited data Single-cell RNA-seq data This study [Database]: Accession # GSE172110

    Reverse Transcription:

    Article Title: Diversity of developing peripheral glia revealed by single-cell RNA sequencing.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti mouse Mbp Abcam Cat # ab40390; RRID: AB_1141521 Rabbit monoclonal to Ki67 Vector Laboratories Cat # VP-RM04; RRID: AB_2336545 Rabbit polyclonal to GFP Abcam Cat # ab6556; RRID: AB_305564 Chicken polyclonal to GFP Aves Cat# GFP-1010; RRID: AB_2307313 Goat polyclonal to Sox10 Santa Cruz Biotechnology Cat# sc-17342-discontinued; RRID: AB_2195374 Mouse monoclonal anti rat Tuj1 Biolegend Cat # 801202; RRID: AB_10063408 Rat monoclonal anti Mbp Abcam Cat# ab7349; RRID: AB_305869 chicken anti-Neurofilament Millipore Sigma Cat# AB5539; RRID: AB_11212161 Donkey anti-rabbit, Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 Donkey anti-goat, Alexa Fluor 647 Invitrogen Cat# A-21447; RRID: AB_2535864 Donkey anti-rabbit, Alexa Fluor 647 Life Technologies Cat# A31573; RRID: AB_2536183 Donkey anti-rabbit, Alexa Fluor 568 Life Technologies Cat# A10042; RRID: AB_2534017 Donkey anti-mouse, Alexa Fluor 647 Life Technologies Cat# A31571; RRID: AB_162542 Donkey anti-rat DyLight 488 Novus Biologicals Cat# NBP1-75383; RRID: AB_11028555 Donkey anti-chicken, Alexa Fluor 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Chemicals, peptides, and recombinant proteins Collagenase IV Worthington Cat# LS004186 Papain Dissociation System (Papain, EBSS, ovomucoid inhibitor, DNAse I) Worthington Cat# LKLK003150 Trypsin Worthington Cat# LS004452 Polystyrene Round-Bottom tube with cellstrainer cap Falcon Cat# 352235 Proteinase K Sigma-Aldrich Cat# P6556 PFA Thermo Fisher Scientific Cat# 50980492 DEPC Sigma-Aldrich Cat# D5758 PBS (10X), RNase-free Life Technologies Cat# AM9624 Triton X-100 Millipore Cat# 648462 ImmEDGE Hydrophobic Barrier Pen Vector Laboratories Cat # NC9545623 SSC (20X) ThermoFisher Cat # 15557-044 Tween-20 Sigma-Aldrich Cat# P2287-500ML Prolong Gold antifade reagent Cell Signaling Technology Cat # 9071S Donkey serum Sigma-Aldrich Cat# D9663 BSA, IgG and protease-free Jackson ImmunoResearch Cat# 001-000-162 DAPI Life Technologies Cat # D1306 Fluoromount-G Southern Biotech Cat# 0100-01 OptiPrep Density Gradient Medium Sigma-Aldrich Cat# D1556-250ML HBSS (10X), calcium, magnesium, no phenol red Life Technologies Cat# 14065056 HBSS (10X), no calcium, no magnesium, no phenol red Life Technologies Cat# 14175103 FBS Sigma-Aldrich Cat# F2442 HEPES (1M) Gibco Cat# 15630-080 5X First Strand Buffer Thermo Fisher Scientific Cat# 18080-044 Igepal CA-630 Sigma-Aldrich Cat# 56741 (Continued on next page) e1 Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER HFE-7500 oil Novec Cat# Novec 7500 MgCl2(1M) (nuclease-free) Thermo Fisher Scientific Cat# AM9530G DTT Invitrogen Cat# 00147 RNaseOUT (40 U/ml) Thermo Fisher Scientific Cat# 10777-019 SuperScript III (200 U/ml) Thermo Fisher Scientific Cat# 18080-044 Carrier oil RAN Biotechnologies Cat# 08-FluoroSurfactant-2wtH-50G Nuclease-free water Life Technologies Cat# 10977015 FastDigest Buffer (10X) Thermo Fisher Scientific Cat# B64 ExoI (20 U/ml) Life Technologies Cat# EN0581 ExoI reaction buffer (10X) NEB Cat# B0293S FastDigest HinfI Thermo Fisher Scientific Cat# FD0804 Agencourt AMPure XP magnetic beads Beckman Coulter Cat# A63881 NEBNext mRNA Second Strand Synthesis Module NEB Cat# E6111S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S RNA Fragmentation Reagents Ambion/Life Technologies Cat# AM8740 dNTP (10 mM each) NEB Cat# N0447L PrimeScript RT-PCR Kit (including PrimeScript Reverse Transcriptase (200 U/ ml) and 5x PrimeScript Buffer) Takara Clontech Cat# RR014A Kapa 2X HiFi HotStart PCR mix Kapa Biosystems Cat# KK2601 EvaGreen Dye (20X) Biotium Cat# 31000-T NextSeq 500 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 BioAnalyzer RNA pico chip and reagents Agilent Cat# 5067-1513 Bioanalyzer HS DNA chip and reagents Agilent Cat# 50674626 Qubit dsDNA HS Assay Kit Life Technologies Cat# Q32851 KAPA Library Quantification Kit Roche Cat# 07960140001 EDTA (0.5M) Thermo Fisher Scientific Cat# 15575020 Tris-HCl, pH 8.0 (1M) Thermo Fisher Scientific Cat# 15568025 Tris-HCl, pH 7.0 (1M) Thermo Fisher Scientific Cat# AM9851 Mineral oil Sigma-Aldrich Cat# M5310-1L NEG-50 frozen section medium Richard-Allan Scientific Cat# 6502 1H,1H,2H,2H-Perfluorooctanol Alfa Aesar Cat# B20156 Ethanol, 200 proof (100%) Decon Labs Cat# 22-032-601 Aquapel Aquapel Cat# 47100 TSA Plus Cyanine 5 PerkinElmer Cat# NEL745E001KT TSA Plus Cyanine 3 PerkinElmer Cat# NEL744E001KT Quadrol (N,N,N’,N’-Tetrakis(2hydroxypropyl)ethylenediamine Tokyo Chemical Industry Cat# T0781 Urea Nacalai Tesque Cat# 35904-45 Sucrose Nacalai Tesque Cat# 30403-55 Triethanolamine (2,2’,2’’-Nitrilotriethanol) Wako Cat# 145-05605 Tri-sodium citrate (dihydrate) Sigma-Aldrich Cat# S1804 Oligonucleotides R1-N6 primer (100 mM) (v3): 5’TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG(N1:25252525) (N1)(N1) (N1)(N1)(N1)3’ This study Integrated DNA Technologies (Continued on next page) Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ai14 The Jackson Laboratory; (Madisen et al., 2010) Rosa26-tdTomato Stock #: 007914 Mouse: NpyCre Qiufu Ma (Dana-Farber Cancer Institute/ Harvard Medical School): (Bourane et al., 2015) Tg(Npy-cre)RH26Gsat/Mmucd MMRRC:034810-UCD Mouse: NPY-GFP The Jackson Laboratory; (van den Pol et al., 2009) B6.FVB-Tg(Npy-hrGFP)1Lowl/J Stock #: 006417 Software and algorithms Conos https://github.com/kharchenkolab/conos N/A Pagoda2 https://github.com/kharchenkolab/ pagoda2 N/A Pagoda2 webpage of single-cell RNA-seq dataset http://pklab.med.harvard.edu/peterk/p2/ smallMem2/index.html?fileURL=http:// pklab.med.harvard.edu/peterk/rosalind/ conE_feb6.bin N/A Indrops pipeline https://github.com/indrops/indrops N/A Processing code of Conos, trajectory and cell composition analyses https://github.com/kharchenkolab/ mouseCochlea N/A Deposited data Single-cell RNA-seq data This study [Database]: Accession # GSE172110

    Polymerase Chain Reaction:

    Article Title: Diversity of developing peripheral glia revealed by single-cell RNA sequencing.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti mouse Mbp Abcam Cat # ab40390; RRID: AB_1141521 Rabbit monoclonal to Ki67 Vector Laboratories Cat # VP-RM04; RRID: AB_2336545 Rabbit polyclonal to GFP Abcam Cat # ab6556; RRID: AB_305564 Chicken polyclonal to GFP Aves Cat# GFP-1010; RRID: AB_2307313 Goat polyclonal to Sox10 Santa Cruz Biotechnology Cat# sc-17342-discontinued; RRID: AB_2195374 Mouse monoclonal anti rat Tuj1 Biolegend Cat # 801202; RRID: AB_10063408 Rat monoclonal anti Mbp Abcam Cat# ab7349; RRID: AB_305869 chicken anti-Neurofilament Millipore Sigma Cat# AB5539; RRID: AB_11212161 Donkey anti-rabbit, Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 Donkey anti-goat, Alexa Fluor 647 Invitrogen Cat# A-21447; RRID: AB_2535864 Donkey anti-rabbit, Alexa Fluor 647 Life Technologies Cat# A31573; RRID: AB_2536183 Donkey anti-rabbit, Alexa Fluor 568 Life Technologies Cat# A10042; RRID: AB_2534017 Donkey anti-mouse, Alexa Fluor 647 Life Technologies Cat# A31571; RRID: AB_162542 Donkey anti-rat DyLight 488 Novus Biologicals Cat# NBP1-75383; RRID: AB_11028555 Donkey anti-chicken, Alexa Fluor 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Chemicals, peptides, and recombinant proteins Collagenase IV Worthington Cat# LS004186 Papain Dissociation System (Papain, EBSS, ovomucoid inhibitor, DNAse I) Worthington Cat# LKLK003150 Trypsin Worthington Cat# LS004452 Polystyrene Round-Bottom tube with cellstrainer cap Falcon Cat# 352235 Proteinase K Sigma-Aldrich Cat# P6556 PFA Thermo Fisher Scientific Cat# 50980492 DEPC Sigma-Aldrich Cat# D5758 PBS (10X), RNase-free Life Technologies Cat# AM9624 Triton X-100 Millipore Cat# 648462 ImmEDGE Hydrophobic Barrier Pen Vector Laboratories Cat # NC9545623 SSC (20X) ThermoFisher Cat # 15557-044 Tween-20 Sigma-Aldrich Cat# P2287-500ML Prolong Gold antifade reagent Cell Signaling Technology Cat # 9071S Donkey serum Sigma-Aldrich Cat# D9663 BSA, IgG and protease-free Jackson ImmunoResearch Cat# 001-000-162 DAPI Life Technologies Cat # D1306 Fluoromount-G Southern Biotech Cat# 0100-01 OptiPrep Density Gradient Medium Sigma-Aldrich Cat# D1556-250ML HBSS (10X), calcium, magnesium, no phenol red Life Technologies Cat# 14065056 HBSS (10X), no calcium, no magnesium, no phenol red Life Technologies Cat# 14175103 FBS Sigma-Aldrich Cat# F2442 HEPES (1M) Gibco Cat# 15630-080 5X First Strand Buffer Thermo Fisher Scientific Cat# 18080-044 Igepal CA-630 Sigma-Aldrich Cat# 56741 (Continued on next page) e1 Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER HFE-7500 oil Novec Cat# Novec 7500 MgCl2(1M) (nuclease-free) Thermo Fisher Scientific Cat# AM9530G DTT Invitrogen Cat# 00147 RNaseOUT (40 U/ml) Thermo Fisher Scientific Cat# 10777-019 SuperScript III (200 U/ml) Thermo Fisher Scientific Cat# 18080-044 Carrier oil RAN Biotechnologies Cat# 08-FluoroSurfactant-2wtH-50G Nuclease-free water Life Technologies Cat# 10977015 FastDigest Buffer (10X) Thermo Fisher Scientific Cat# B64 ExoI (20 U/ml) Life Technologies Cat# EN0581 ExoI reaction buffer (10X) NEB Cat# B0293S FastDigest HinfI Thermo Fisher Scientific Cat# FD0804 Agencourt AMPure XP magnetic beads Beckman Coulter Cat# A63881 NEBNext mRNA Second Strand Synthesis Module NEB Cat# E6111S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S RNA Fragmentation Reagents Ambion/Life Technologies Cat# AM8740 dNTP (10 mM each) NEB Cat# N0447L PrimeScript RT-PCR Kit (including PrimeScript Reverse Transcriptase (200 U/ ml) and 5x PrimeScript Buffer) Takara Clontech Cat# RR014A Kapa 2X HiFi HotStart PCR mix Kapa Biosystems Cat# KK2601 EvaGreen Dye (20X) Biotium Cat# 31000-T NextSeq 500 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 BioAnalyzer RNA pico chip and reagents Agilent Cat# 5067-1513 Bioanalyzer HS DNA chip and reagents Agilent Cat# 50674626 Qubit dsDNA HS Assay Kit Life Technologies Cat# Q32851 KAPA Library Quantification Kit Roche Cat# 07960140001 EDTA (0.5M) Thermo Fisher Scientific Cat# 15575020 Tris-HCl, pH 8.0 (1M) Thermo Fisher Scientific Cat# 15568025 Tris-HCl, pH 7.0 (1M) Thermo Fisher Scientific Cat# AM9851 Mineral oil Sigma-Aldrich Cat# M5310-1L NEG-50 frozen section medium Richard-Allan Scientific Cat# 6502 1H,1H,2H,2H-Perfluorooctanol Alfa Aesar Cat# B20156 Ethanol, 200 proof (100%) Decon Labs Cat# 22-032-601 Aquapel Aquapel Cat# 47100 TSA Plus Cyanine 5 PerkinElmer Cat# NEL745E001KT TSA Plus Cyanine 3 PerkinElmer Cat# NEL744E001KT Quadrol (N,N,N’,N’-Tetrakis(2hydroxypropyl)ethylenediamine Tokyo Chemical Industry Cat# T0781 Urea Nacalai Tesque Cat# 35904-45 Sucrose Nacalai Tesque Cat# 30403-55 Triethanolamine (2,2’,2’’-Nitrilotriethanol) Wako Cat# 145-05605 Tri-sodium citrate (dihydrate) Sigma-Aldrich Cat# S1804 Oligonucleotides R1-N6 primer (100 mM) (v3): 5’TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG(N1:25252525) (N1)(N1) (N1)(N1)(N1)3’ This study Integrated DNA Technologies (Continued on next page) Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ai14 The Jackson Laboratory; (Madisen et al., 2010) Rosa26-tdTomato Stock #: 007914 Mouse: NpyCre Qiufu Ma (Dana-Farber Cancer Institute/ Harvard Medical School): (Bourane et al., 2015) Tg(Npy-cre)RH26Gsat/Mmucd MMRRC:034810-UCD Mouse: NPY-GFP The Jackson Laboratory; (van den Pol et al., 2009) B6.FVB-Tg(Npy-hrGFP)1Lowl/J Stock #: 006417 Software and algorithms Conos https://github.com/kharchenkolab/conos N/A Pagoda2 https://github.com/kharchenkolab/ pagoda2 N/A Pagoda2 webpage of single-cell RNA-seq dataset http://pklab.med.harvard.edu/peterk/p2/ smallMem2/index.html?fileURL=http:// pklab.med.harvard.edu/peterk/rosalind/ conE_feb6.bin N/A Indrops pipeline https://github.com/indrops/indrops N/A Processing code of Conos, trajectory and cell composition analyses https://github.com/kharchenkolab/ mouseCochlea N/A Deposited data Single-cell RNA-seq data This study [Database]: Accession # GSE172110

    Library Quantification:

    Article Title: Diversity of developing peripheral glia revealed by single-cell RNA sequencing.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti mouse Mbp Abcam Cat # ab40390; RRID: AB_1141521 Rabbit monoclonal to Ki67 Vector Laboratories Cat # VP-RM04; RRID: AB_2336545 Rabbit polyclonal to GFP Abcam Cat # ab6556; RRID: AB_305564 Chicken polyclonal to GFP Aves Cat# GFP-1010; RRID: AB_2307313 Goat polyclonal to Sox10 Santa Cruz Biotechnology Cat# sc-17342-discontinued; RRID: AB_2195374 Mouse monoclonal anti rat Tuj1 Biolegend Cat # 801202; RRID: AB_10063408 Rat monoclonal anti Mbp Abcam Cat# ab7349; RRID: AB_305869 chicken anti-Neurofilament Millipore Sigma Cat# AB5539; RRID: AB_11212161 Donkey anti-rabbit, Alexa Fluor 488 Thermo Fisher Scientific Cat# A21206; RRID: AB_2535792 Donkey anti-goat, Alexa Fluor 647 Invitrogen Cat# A-21447; RRID: AB_2535864 Donkey anti-rabbit, Alexa Fluor 647 Life Technologies Cat# A31573; RRID: AB_2536183 Donkey anti-rabbit, Alexa Fluor 568 Life Technologies Cat# A10042; RRID: AB_2534017 Donkey anti-mouse, Alexa Fluor 647 Life Technologies Cat# A31571; RRID: AB_162542 Donkey anti-rat DyLight 488 Novus Biologicals Cat# NBP1-75383; RRID: AB_11028555 Donkey anti-chicken, Alexa Fluor 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Chemicals, peptides, and recombinant proteins Collagenase IV Worthington Cat# LS004186 Papain Dissociation System (Papain, EBSS, ovomucoid inhibitor, DNAse I) Worthington Cat# LKLK003150 Trypsin Worthington Cat# LS004452 Polystyrene Round-Bottom tube with cellstrainer cap Falcon Cat# 352235 Proteinase K Sigma-Aldrich Cat# P6556 PFA Thermo Fisher Scientific Cat# 50980492 DEPC Sigma-Aldrich Cat# D5758 PBS (10X), RNase-free Life Technologies Cat# AM9624 Triton X-100 Millipore Cat# 648462 ImmEDGE Hydrophobic Barrier Pen Vector Laboratories Cat # NC9545623 SSC (20X) ThermoFisher Cat # 15557-044 Tween-20 Sigma-Aldrich Cat# P2287-500ML Prolong Gold antifade reagent Cell Signaling Technology Cat # 9071S Donkey serum Sigma-Aldrich Cat# D9663 BSA, IgG and protease-free Jackson ImmunoResearch Cat# 001-000-162 DAPI Life Technologies Cat # D1306 Fluoromount-G Southern Biotech Cat# 0100-01 OptiPrep Density Gradient Medium Sigma-Aldrich Cat# D1556-250ML HBSS (10X), calcium, magnesium, no phenol red Life Technologies Cat# 14065056 HBSS (10X), no calcium, no magnesium, no phenol red Life Technologies Cat# 14175103 FBS Sigma-Aldrich Cat# F2442 HEPES (1M) Gibco Cat# 15630-080 5X First Strand Buffer Thermo Fisher Scientific Cat# 18080-044 Igepal CA-630 Sigma-Aldrich Cat# 56741 (Continued on next page) e1 Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER HFE-7500 oil Novec Cat# Novec 7500 MgCl2(1M) (nuclease-free) Thermo Fisher Scientific Cat# AM9530G DTT Invitrogen Cat# 00147 RNaseOUT (40 U/ml) Thermo Fisher Scientific Cat# 10777-019 SuperScript III (200 U/ml) Thermo Fisher Scientific Cat# 18080-044 Carrier oil RAN Biotechnologies Cat# 08-FluoroSurfactant-2wtH-50G Nuclease-free water Life Technologies Cat# 10977015 FastDigest Buffer (10X) Thermo Fisher Scientific Cat# B64 ExoI (20 U/ml) Life Technologies Cat# EN0581 ExoI reaction buffer (10X) NEB Cat# B0293S FastDigest HinfI Thermo Fisher Scientific Cat# FD0804 Agencourt AMPure XP magnetic beads Beckman Coulter Cat# A63881 NEBNext mRNA Second Strand Synthesis Module NEB Cat# E6111S HiScribe T7 High Yield RNA Synthesis Kit NEB Cat# E2040S RNA Fragmentation Reagents Ambion/Life Technologies Cat# AM8740 dNTP (10 mM each) NEB Cat# N0447L PrimeScript RT-PCR Kit (including PrimeScript Reverse Transcriptase (200 U/ ml) and 5x PrimeScript Buffer) Takara Clontech Cat# RR014A Kapa 2X HiFi HotStart PCR mix Kapa Biosystems Cat# KK2601 EvaGreen Dye (20X) Biotium Cat# 31000-T NextSeq 500 High Output v2 Kit (75 cycles) Illumina Cat# FC-404-2005 BioAnalyzer RNA pico chip and reagents Agilent Cat# 5067-1513 Bioanalyzer HS DNA chip and reagents Agilent Cat# 50674626 Qubit dsDNA HS Assay Kit Life Technologies Cat# Q32851 KAPA Library Quantification Kit Roche Cat# 07960140001 EDTA (0.5M) Thermo Fisher Scientific Cat# 15575020 Tris-HCl, pH 8.0 (1M) Thermo Fisher Scientific Cat# 15568025 Tris-HCl, pH 7.0 (1M) Thermo Fisher Scientific Cat# AM9851 Mineral oil Sigma-Aldrich Cat# M5310-1L NEG-50 frozen section medium Richard-Allan Scientific Cat# 6502 1H,1H,2H,2H-Perfluorooctanol Alfa Aesar Cat# B20156 Ethanol, 200 proof (100%) Decon Labs Cat# 22-032-601 Aquapel Aquapel Cat# 47100 TSA Plus Cyanine 5 PerkinElmer Cat# NEL745E001KT TSA Plus Cyanine 3 PerkinElmer Cat# NEL744E001KT Quadrol (N,N,N’,N’-Tetrakis(2hydroxypropyl)ethylenediamine Tokyo Chemical Industry Cat# T0781 Urea Nacalai Tesque Cat# 35904-45 Sucrose Nacalai Tesque Cat# 30403-55 Triethanolamine (2,2’,2’’-Nitrilotriethanol) Wako Cat# 145-05605 Tri-sodium citrate (dihydrate) Sigma-Aldrich Cat# S1804 Oligonucleotides R1-N6 primer (100 mM) (v3): 5’TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG(N1:25252525) (N1)(N1) (N1)(N1)(N1)3’ This study Integrated DNA Technologies (Continued on next page) Developmental Cell 56, 2516–2535.e1–e8, September 13, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ai14 The Jackson Laboratory; (Madisen et al., 2010) Rosa26-tdTomato Stock #: 007914 Mouse: NpyCre Qiufu Ma (Dana-Farber Cancer Institute/ Harvard Medical School): (Bourane et al., 2015) Tg(Npy-cre)RH26Gsat/Mmucd MMRRC:034810-UCD Mouse: NPY-GFP The Jackson Laboratory; (van den Pol et al., 2009) B6.FVB-Tg(Npy-hrGFP)1Lowl/J Stock #: 006417 Software and algorithms Conos https://github.com/kharchenkolab/conos N/A Pagoda2 https://github.com/kharchenkolab/ pagoda2 N/A Pagoda2 webpage of single-cell RNA-seq dataset http://pklab.med.harvard.edu/peterk/p2/ smallMem2/index.html?fileURL=http:// pklab.med.harvard.edu/peterk/rosalind/ conE_feb6.bin N/A Indrops pipeline https://github.com/indrops/indrops N/A Processing code of Conos, trajectory and cell composition analyses https://github.com/kharchenkolab/ mouseCochlea N/A Deposited data Single-cell RNA-seq data This study [Database]: Accession # GSE172110



    Similar Products

    5x primescript buffer takara clontech  (TaKaRa)
    98
    TaKaRa 5x primescript buffer takara clontech
    5x Primescript Buffer Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5x+primescript+buffer+takara+clontech/PrimeScript+RT-PCR+Kit/pm34469751-374-133-136
    Average 98 stars, based on 1 article reviews
    5x primescript buffer takara clontech - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier

    Image Search Results